Ccdc32^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACCATTTATAAACAAGA and GCACGCTTCTGTGTTGAACT, which resulted in a 440 bp deletion beginning at Chromosome 2 position 119,026,982 bp and ending after 119,027,421 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000356296 (exon 1) and 190 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)