Fitm1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGAGGACTGACGGTCAACA and GTACGTGACTTCCATCCTGT, which resulted in a 1578 bp deletion beginning at Chromosome 14 position 55,575,498 bp and ending after 55,577,075 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124452 and ENSMUSE00000317360 (exons 1 and 2) and 607 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)