Dmrt1^em1Zark

CRISPR/cas9 endonuclease-mediated genome editing was used to create asparagine to glycine substitution at position 109 (R109G in the mouse, R111G in human) the using Ensembl Canonical Transcript: ENSMUST00000025755.11 Dmrt1-201. The CRISPR guide sequence was CCCGCTGTCGCTCCGCAATC and the repair template was 5'-GGCCACAAGCGCTTCTGCATGTGGCGGGATTGCCAGTGCAAGAAGTGCAGTCTGATCGCGGAGGGACAGCGGGTGATGGCCGCGCAGGTGGCCCTGAGAAGACAGCAGGCCCA-3'. The repair template includes two silent changes that remove the PAM sequence and generate a restriction enzyme recognition site, as well as R109G. The R109G mutation alters the DNA binding motif. The mutation models a de novo human mutation in DMRT1 associated with dominant complete gonadal dysgenesis and 46,XY sex reversal. (J:330224)