This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTATCCGCAGAATCACAG and GTCCACTTTCACCTGTCTGG, which resulted in a 2685 bp deletion beginning at Chromosome 11 position 49,966,962 bp and ending after 49,969,646 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001287950 and ENSMUSE00001274105 (exons 7 and 8) and 2492 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 238 and early truncation 2 amino acids later. (J:188991)