This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGGTGCATATGAGCTCCA and GCTGTATTGATCCTTGTCAG, which resulted in a 355 bp deletion beginning at Chromosome 4 position 119,436,957 bp and ending after 119,437,311 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000662211 (exon 3) and 183 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 4 amino acids later. (J:188991)