This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTCAACCCAGACGTCCAA and GTTTTGCTGTTGCAAGAGGG, which resulted in a 1922 bp deletion beginning at Chromosome 9 position 111,467,422 bp and ending after 111,469,343 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001026186 (exon 2) and 84 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 3 amino acids later. (J:188991)