Nudt16l1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTCCAGCTCAAGTGACAG and CTGAGGGCAACCAATCTCAG, which resulted in a 2443 bp deletion beginning at Chromosome 16 position 4,938,671 bp and ending after 4,941,113 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001438399, ENSMUSE00000127761, and ENSMUSE00001442417 (exons 1-3) and 825 bp of flanking and intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. (J:188991)