This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGGACCACAGATGCACAG and TACCATTGCAGTTTACCCTG, which resulted in a 472 bp deletion beginning at Chromosome 4 position 144,419,612 bp and ending after 144,420,083 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000180466 (exon 3) and 294 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 8 amino acids later. (J:188991)