Alt-R CRISPR RNAs (CCTGCATTTCCCCAGCCATG and AAGCAGAATGGCCAGCCACA) are designed delete part of exon 1 and intron 1. Specifically, 168 bp of contiguous DNA from nucleotide position 150,412,438 to 150,412,605 inclusive (nucleotide position from mouse genome build GRCm39, Ensembl release 107). The deletion begins one nucleotide upstream of the translation initiation ATG codon in exon 1 and extends 100 nucleotides into intron 1. (J:101977)