Arid5a^em1Gaff

CRISPR/cas9 genome editing uses sgRNAs (ATAGGCTCTGGCCTACAGTTTGG and GTAAAAGCCAAATGCGCCCCAGG) to insert a loxP site in intron 2 and a Myc-tag at the C-terminal, with another loxP site, just after the stop codon. A founder was identified carrying a deletion between the two SpyCas9 target sites, with a deletion of 3,359 bp deletion on chromosome 1 between position 36,316,840 and 36,320,199 (exons 3-6 and part of exon 7). (J:331508)