This allele was generated by a 3' loxP site insertion in intron 5 via electroporation of C57BL/6J zygotes of CRISPR/Cas9 RNP (sgRNA sequence TTGTGACCATTTGTCTGCAA; chr11:118,287,207-118,287,226 GRCm39/mm39) and a loxP-containing ssDNA oligonucleotide (200bp). Subsequent CRISPR/Cas9-targeting with RNPs (sgRNA sequence CAATGTCCCGTTGCTAAGTG - Chr11:118289852-118289871 GRCm39/mm39) and a ssDNA oligonucleotide (200bp) inserted the 5' loxP site in intron 2, to generate the final conditional mouse model. (J:329329)