This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGTAGGACATATTTCCCAG and CTAGGGGTGGAGATACACTT, which resulted in a 4837 bp deletion beginning at Chromosome 11 position 117,809,495 bp and ending after 117,814,331 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001246954, ENSMUSE00000151668, ENSMUSE00001250072 and ENSMUSE00000402864 (exons 1-4) and 866 bp of flanking intronic sequence including the start site, splice acceptor and donor as well as 3 UTR and is predicted to result in a null allele. (J:188991)