Clu^{em1(CLU*)Aduci}

Guide RNAs (GCAGATCCATATCTGGCTGA, TTGCCCCCTTCAGCCAGATA, TGAACTGCCCTCGCTTGTAC and CTTGAGTGCCTGTACAAGCG) are designed to replace part of the gene with an approximately 2kb region of human DNA sequence, including a human SNP rs2279590. To humanize the 3' end of the locus, the human SNP rs2279590 was introduced; the SNP has been associated with increased risk of late-onset Alzheimer's disease (LOAD). Specifically, DNA sequence from nucleotide position 27,596,915 to 27,598,786 (inclusive) on human chromosome 8 (GRCh38) is inserted between nucleotide positions 66,218,203 and 66,220,390 on mouse chromosome 14 (GRCm39), replacing the intervening mouse genomic DNA sequence. (J:101977)