CRISPR/cas9 endonuclease-mediated genome editing was used to insert an in frame protein containing Sp7-P2A-Flpo sequence- polyA into the 3' UTR of the gene The self-cleaving P2A sequence allows for expression of Sp7 and flpo recombinase. Cas9 protein, sgRNA (gatctgagctgggtagaggaagg), and ssDNA donor were mixed and injected into the pronucleus of C57BL/6J x SJL fertilized zygotes. (J:325967)