Zfp691^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACCTGAATGAACATCCACA and AACTGTGTATACCGTCCCCC, which resulted in a 1801 bp deletion beginning at Chromosome 4 position 119,169,330 bp and ending after 119,171,130 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000669588 (exon 2) and 271 bp of flanking intronic sequence including the splice acceptor, the ATG start site and 3 UTR, and is predicted to result in a null allele. (J:188991)