This allele was generated at The Jackson Laboratory by microinjecting Cas9 mRNA and 2 guide sequences GGGTTATCTAAACAGAAGAC and TGGGTACCTTTAGCTTAAAA, which resulted in a 999 bp deletion beginning at Chromosome 3 position 5,396,372 bp and ending after 5,397,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000149284 and ENSMUSE00000512464 (exons 7 and 8) and 667 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1142 and early truncation 4 amino acids later. There is a 1 bp insertion [G] at the deletion site. (J:188991)