Mxd4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGAACCAATGCTGCCCAA and GCAAGCCTACAGCAGCGCAG, which resulted in a 274 bp deletion beginning at Chromosome 5 position 34,178,762 bp and ending after 34,179,035 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000242767 (exon 4) and 159 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 9 amino acids later. (J:188991)