CRISPR/cas9 genome editing using guide RNAs upstream (GTATTTACTAAAGGACTGTC and CTAAAGGACTGTCAGGAATC) and downstream (ATGAGCCTTCTTCCTAGGCC and CCTGTCAGAGATCCAGGCCT) were selected to target exon 2. Donor DNAs were originally designed to introduce loxP sites flanking exon 2. DNA sequencing of the targeted region identified founder 5022 with a 6 bp insertion followed by a 654 bp deletion (GTATTTACTAAAGGAC/aggctc/TGT/del654/CAGGCTCATGTGTGGGTAGATAGGGAGC). (J:94077)