Kif1a^em2Lutzy

CRISPR/cas9 genome editing used guide RNAs (TCAATACGGAGTCTCGGTAA, GTCAATACGGAGTCTCGGTA, and TGTCAATACGGAGTCTCGGTA) to target exon 11. Donor DNAs were created encoding a P305L mutation (CCT to CTT, proline to leucine) and a silent mutation I304I (ATC to ATA) that introduces a Setl site. The P305L (proline to leucine) mutation was identified in children with KIF1A-associated neurological disorder (KAND), a neurodegenerative condition. (J:101977)