Gt(ROSA)26Sor^{em3(CAG-ZsGreen1)Jahe}

CRISPR/Cas9 genome editing removed the transcriptional stop cassette and flanking loxP sites in the existing Rosa-CAG-LSL-ZsGreen1-WPRE conditional allele using guides 5 AAAGAATTGATTTGATACCG (PAM CGG) and 5 GTATGCTATACGAAGTTATT (PAM AGG) to activate ZsGreen1 expression. Subsequently, CRISPR/Cas9 genome editing with a single-stranded DNA in mouse embryos from this seed line was used to introduce sequence harboring a guide target site and PAMs compatible with A.s. and L.b Cas12a, SauCas9, and SpyCas9 [5 TTTGTATGCTATACGAAGTTATTAGGAGT]. Introduction of this sequence disrupted the ZsGreen1 chromophore and introduced a premature stop codon, which disrupts ZsGreen1 expression and fluorescence. Homology-directed repair with a DNA donor can restore ZsGreen1 sequence, expression, and fluorescence. (J:302569)