This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGATCTTACTTGAGTAAGG and AAGTGAAAGAGACGTGTACG, which resulted in a 4192 bp deletion beginning at Chromosome 16 position 87,284,234 bp and ending after 87,288,425 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001223260, ENSMUSE00001206188, ENSMUSE00001252459, ENSMUSE00001247901, ENSMUSE00001275047 (exons 4-8) and 3482 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 77 and early truncation 11 amino acids later. (J:188991)