This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGATGGCCGGCTCCCACG and TTCAAAACGTGTGTACCAGT, which resulted in a 3088 bp deletion beginning at Chromosome 7 position 4,921,793 bp and ending after 4,924,880 bp (GRCm39/mm39). This mutation deletes 3088 bp from ENSMUSE00000705973 (exon 3) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 34 amino acids later. (J:188991)