This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAACTCTGATTAGCAACAT and GTTTTCACACTGATCATCAT, which resulted in a 377 bp deletion beginning at Chromosome 1 position 105,928,427 bp and ending after 105,928,803 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000540887 (exon 2) and 265 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 306 and early truncation 6 amino acids later. (J:188991)