Chmp1b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACAGATGCTTCTCCATGT and GCCGTCAGACTTGATCCCGA, which resulted in a 583 bp deletion beginning at Chromosome 18 position 67,338,578 bp and ending after 67,339,160 bp (GRCm39/mm39). This mutation deletes 583 bp from ENSMUSE00001382908 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 19 amino acids later. (J:188991)