This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAATGAGTATGGATTTTC and AGCCAGCAGAGAATCTTAAG, which resulted in an 855 bp deletion beginning at Chromosome 7 position 29,861,159 bp and ending after 29,862,013 bp (GRCm39/mm39). This mutation deletes 855 bp from ENSMUSE00000393840 (exon 2) and is predicted to cause a change of amino acid sequence after residue 9 and termination 17 amino acids later. There is a 1 bp insertion (C) at the deletion site. (J:188991)