The gene was targeted with two gRNAs (targeting GAACTTGTCAAACTTATCCA and CGGTGCAACCATGCTTCTTC) using CRISPR/Cas9 technology, leading to a 199 bp deletion that includes the exon 2 splice acceptor and most of exon 2 (chr15:7690182276902020 (GRCm39)) in founder 14. This deletion causes the skipping of exon 2 and splicing of exon 1 to 3, which results in a reading frame shift and premature stop codon. (J:307655)