Arl14^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGTCCGAGGAGAAGAATGT and TTTCTGCTTGAAGATTGCTA, which resulted in a 524 bp deletion beginning at Chromosome 3 position 69,129,897 bp and ending after 69,130,420 bp (GRCm39/mm39). This mutation deletes 524 bp from ENSMUSE00001258649 (exon 1) and is predicted to cause a change of amino acid sequence after residue 14 and termination 6 amino acids later. (J:188991)