Tmem229b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGGTGACTAGAGAGAGCGA and TAGACAATAGGGACGATGGT, which resulted in a 3696 bp deletion beginning at Chromosome 12 position 79,008,403 bp and ending after 79,012,098 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000932830 (exon 3) and 322 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to result in a null allele. (J:188991)