Cfap47^em1Fzh

Exon 15 was targeted with an sgRNA (targeting CCTGTTTTCGTGGTACAGTTAGG) using CRISPR/Cas9 technology, resulting in the insertion or duplication of a T in the coding sequence (c.2559insT) that causes a frameshift and premature stop codon. RT-qPCR showed reduced transcript expression from this allele in testes and immunohistochemistry experiments showed absence of protein expression. (J:307391)