Zfp750^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCAGTGCTATGGCTAGAGAG and GACTCATTATCCTTTGTGTT, which resulted in a 2279 bp deletion beginning at Chromosome 11 position 121,402,605 bp and ending after 121,404,883 bp (GRCm39). This mutation deletes 1431 bp of ENSMUSE00000307208 exon 2, 127 bp of intron 2-3 and 721 bp of ENSMUSE00000367226 exon 3 including the splice acceptor, start site splice donor and termination codon. This allele is predicted to be a null. (J:188991)