Gm16685^em1Osb

The genomic sequence containing two conserved NFKB-binding motifs, in the promoter upstream of the locus, was targeted with crRNAs (targeting AGGGTTTAAAAGCGCATCC and AGTCTGGGAGTTTCCGATCC) and tracrRNAs using CRISPR/Cas9 technology, resulting in an 79 bp deletion. RT-qPCR experiments confirmed the lack of transcript expression from this allele and hat there was no effect on the expression of the overlapping Il7 gene on the opposite strand. (J:303079)