Mpzl1^em1Ambt

Tyrosine codon 242 (TAC) was changed to a phenylalanine codon (TTC) (p.Y242F) through an A-to-T mutation (T-to-A on forward strand) using an sgRNA (targeting TCTAACTGTGCGTAAATGACTGG) and ssODN template with CRISPR/Cas9 technology. Also, two silent mutations were engineered upstream to create an AgeI diagnostic restriction site. The mutation renders the encoded peptide tyrosyl phosphorylation-defective, not only at the targeted Tyr242 but also at Tyr264. (J:301775)