Rbpj^em2Lutzy

CRISPR/cas9 genome editing is used to insert loxP sites on either side of exon 4. A double stranded oligonucleotide donor DNA with a 1.6-kb left arm, a 1.1-kb right arm, two loxP sequence elements [with the sequence ATAACTTCGTATAGCATACATTATACGAAGTTAT] and all of exon 4 is used to generate the floxed allele. The 5' loxP sequence is positioned 211nt 5' of exon 4 and the 3' loxP sequence is positioned 170nt 3' of exon 4. Progeny were screened by DNA sequencing to identify correctly targeted pups. (J:101977)