Gcn1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGAGCAGGGCTCAGCA and GCTGGTGTAGAGCCACTGGT, which resulted in a 1611 bp deletion beginning at Chromosome 5 position 115,574,333 bp and ending after 115,575,943 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249622, ENSMUSE00001219534(exons 3 and 4) and 1415 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 11 amino acids later. (J:188991)