Slc16a5^em#Memo

Exon 2 was targeted with sgRNAs (AGCATCTTGGTCAAACATTTCGG, CTGTGATCACTCCTGCGGTGAGG) using CRISPR/Cas9 technology, resulting in two mutant mouse lines: a 105 bp deletion and unknown size insertion in one line and a108 bp deletion in the other. The pound # symbol is used where the specific allele used is not mentioned or where the alleles are pooled. (J:293663)