Guide RNAs (GTACGCTGGTCACTGGACAG and CTGTCCAGTGACCAGCGTAC) are designed to insert an extra adenine at position 1826 (c.1826dupA), resulting in a tyrosine change to a premature stop codon at amino acid 609 (Tyr609*). This mutation results in a truncated protein as seen in patients with Infantile Onset Pompe Disease (IOPD). Silent protospacer adjacent motif (PAM) site mutations (GaaA>, GaaA>) and a gRNA seed region mutation (GaaT>) were also introduced to prevent gRNA editing of the donor template. (J:294027)