This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTATGATTCCAAAACCAGG and TCATTACATTAGAGTTAACT, which resulted in a 952 bp deletion beginning at Chromosome 1 position 151,410,586 bp and ending after 151,411,537 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000259668 (exon 6) and 264 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 20 amino acids later. (J:188991)