Gm7694^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTACAACTGGGATAATGGG and GCAATATACCCCAAACCTTC, which resulted in a 516 bp deletion beginning at Chromosome 1 position 170,302,481 bp and ending after 170,302,996 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000687523 (exon 2) and 188 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)