This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGGTGCTGAACCAGAGGT and GCACAGGTGAGAATTACAGC, which resulted in a 435 bp deletion beginning at Chromosome 3 position 89,243,529 bp and ending after 89,243,963 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000638204 (exon 3) and 91 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 109 and early truncation 14 amino acids later. (J:188991)