This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAAACCAAGTCAGTACGG and ACTCAGTGTATGATCAAGAG, which resulted in a 207 bp deletion beginning at Chromosome 9 position 102,525,368 bp and ending after 102,525,574 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000322180 (exon 6) and 124 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 133 and early truncation 8 amino acids later. (J:188991)