Mbtps2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATACAAACGATTACATCACT and TTTTACGGTTTCCTTTAAAT, which resulted in a 329 bp deletion beginning at Chromosome X position 157,575,872 bp and ending after 157,576,200 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220470 (exon 4) and 225 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 142 and early truncation 5 amino acids later. (J:188991)