This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGGAAGAGTGGTATCCCTA and CTGATACCCACCCTTTTGGG, which resulted in a 1739 bp deletion beginning at Chromosome 2 position 119,210,339 bp and ending after 119,212,077 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001306003, ENSMUSE00001248239, ENSMUSE00001215428, ENSMUSE00001213383, ENSMUSE00001275938 (exons 2 through 6) and 1192 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 61 amino acids later. (J:188991)