This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGAGCTTCCCGGAGAGAGC and GGCGTTGGGGCCGCGGGCGT, which resulted in a 432 bp deletion beginning at Chromosome 7 position 28,277,795 bp and ending after 28,278,226 bp (GRCm38/mm10). This mutation deletes 432 bp of ENSMUSE00000597783 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 9 amino acids later. (J:188991)