This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTTTAAAAAGGTGGCAGC and TTTAAGACGCTTTGACCCCG, which resulted in a 4975 bp deletion beginning at Chromosome 18 position 35,650,319 bp and ending after 35,655,293 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001322141 (exon 1) and 87 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)