This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTCTTTGATGTCGGATGA and TGACTCCTTGCTCTCAGGTC, which resulted in a 1168 bp deletion beginning at Chromosome 11 position 62,779,722 bp and ending after 62,780,889 bp (GRCm38/mm10). This mutation deletes 1168 bp of ENSMUSE00000355028 (exon 4) and is predicted to cause a change of amino acid sequence after residue 119 and termination 14 amino acids later. (J:188991)