Aco2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTTTCCCTCTCACATGTG and AGTGCCATGGAAAGACTGAC, which resulted in a 418 bp deletion beginning at Chromosome 15 position 81,895,108 bp and ending after 81,895,525 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000127355 (exon 3) and 159 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 1 amino acids later. (J:188991)