This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAAGGAGAGAGTTCGGCGT and TTTGAATGAGAGAAATTCAC, which resulted in a 6247 bp deletion beginning at Chromosome 12 position 76,239,314 bp and ending after 76,245,560 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000369176 and ENSMUSE00000284491 (exons 2 and 3) and 5767 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)