This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCTACAGTTGTGAGATTTG and AATATGGAAAAGTTTTTGAG, which resulted in a 1775 bp deletion beginning at Chromosome 13 position 67,592,123 bp and ending after 67,593,897 bp (GRCm38/mm10). This mutation deletes 1775 bp from ENSMUSE00000465644 (exon 4) and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 6 amino acids later. (J:188991)