Fahd1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGGCTTGTCAGTTCCCTA and TTGGCTGTGAACTCTATGGG, which resulted in a 1932 bp deletion beginning at Chromosome 17 position 24,848,493 bp and ending after 24,850,424 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000343391 (exon 1) and 459 bp of flanking intronic sequence including the splice acceptor, donor and start site. It is predicted to generate a null allele. (J:188991)