Zfhx4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGAGTCACAGGTTTCCA and ACAGCAGCGGCTCTGGCACC, which resulted in a 2576 bp deletion beginning at Chromosome 3 position 5,241,715 bp and ending after 5,244,290 bp (GRCm38/mm10). This mutation deletes 2576 bp of ENSMUSE00000386485 (exon 2) including the start site and is predicted to generate a null allele. (J:188991)